View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10052_low_12 (Length: 369)
Name: NF10052_low_12
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10052_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 161 - 351
Target Start/End: Complemental strand, 25547251 - 25547061
Alignment:
Q |
161 |
attattttttaagttggatcaactcgaatggcatccaatttcataaaatagcatatttctgttgaccccctccaacatattattgagagtgctctatgta |
260 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25547251 |
attattttttaagttgattcaactcgattggcatccaatttcataaaatagcatatttctgttgaccccctccaacatattattgagagtgctctatgta |
25547152 |
T |
 |
Q |
261 |
ctcttcgtgatcaaaattggtgatattgcgaannnnnnnnnnnnnnnngaaagatggtgatagtgtagtgtagatgtatgtgtttcttttg |
351 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25547151 |
ctcttcgtgatcaaaattggtgatattgcgaattttattttattttttgaaagatggtgatagtgtagtgtagatgtatgtgtttcttttg |
25547061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 23 - 168
Target Start/End: Complemental strand, 25547634 - 25547491
Alignment:
Q |
23 |
gatcaatggtcgcttacacatcatttgtaaaaggattctttgactaggcaaaaatgtatgtttttcgctatgattaactatgaatctgtgttggttatat |
122 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| || |
|
|
T |
25547634 |
gatcaatggtcgcttacacatcatttgtaaaaggaatctctgactaggcaaaaatgtattttttttgctatggttaactatgaatttgtgttggtt--at |
25547537 |
T |
 |
Q |
123 |
atttttataggatgatgcgtaatatttctctccacctcattatttt |
168 |
Q |
|
|
||||||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
T |
25547536 |
atttttatatgatgatgcgtaatatttctctcccccttattatttt |
25547491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University