View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10052_low_16 (Length: 317)
Name: NF10052_low_16
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10052_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 38458989 - 38458854
Alignment:
| Q |
1 |
attcttcccctaccataacctttgtcacgctctcaatctttctctatcgccacgtctttgagttctcagaatcttggtcgctcagttcatagtcttaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38458989 |
attcttcccctaccataacctttgtcacgctctcaatctttctctgtcgccgagtct--gagttctcagaatcttggtcgctcagttcatagtcttaatt |
38458892 |
T |
 |
| Q |
101 |
ctcactagaaatccattgagaaaggttagtgaatcaca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38458891 |
ctcactagaaatccattgagaaaggttagtgaatcaca |
38458854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 227 - 300
Target Start/End: Complemental strand, 38458769 - 38458696
Alignment:
| Q |
227 |
tgtgttccttcaaatttgatttgctgccaatttgtgattttgggttttagggttgctttaaatttgctttgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38458769 |
tgtgttccttcaaatttgatttgctgccaatttgtgattttgggttttagggttgctttaaatttgatttgatg |
38458696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 22978995 - 22978963
Alignment:
| Q |
1 |
attcttcccctaccataacctttgtcacgctct |
33 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
22978995 |
attcttcccctaccagaacctttgtcacgctct |
22978963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 241 - 291
Target Start/End: Original strand, 34384865 - 34384915
Alignment:
| Q |
241 |
tttgatttgctgccaatttgtgattttgggttttagggttgctttaaattt |
291 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| ||||||||||||||| |
|
|
| T |
34384865 |
tttgatttgctgccaattagtgattttgagttttatggttgctttaaattt |
34384915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 245 - 291
Target Start/End: Original strand, 11037374 - 11037420
Alignment:
| Q |
245 |
atttgctgccaatttgtgattttgggttttagggttgctttaaattt |
291 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
11037374 |
atttgctgccaattagtgattttgagttttagagttgctttaaattt |
11037420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University