View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10052_low_25 (Length: 222)
Name: NF10052_low_25
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10052_low_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2765423 - 2765644
Alignment:
| Q |
1 |
gaacaagcaatggatatgagtgtgtgtaaatccgtcctgtttcaagagtcgatatgcgaattctcaccttcccaattttcaagtctttgttgtgaccctt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765423 |
gaacaagcaatggatacgagtgtgtgtaaatccgtcctgtttcaagagtcgatatgcgaattctcaccttcccaattttcaagtctttgttgtgaccctt |
2765522 |
T |
 |
| Q |
101 |
ttcaccactgatttgggaattgtcaaagacacctactgtgaggactgtggcaggatcaaagacctcccaagtgtattgctcattgtattttggcgacaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2765523 |
ttcaccactgatttgggaattgtcaaagacacctactgtgaggactgtggcaggatcaaagacctcccaagtgtattgctcgttgtattttggcgacaag |
2765622 |
T |
 |
| Q |
201 |
ttgtcaacaagtgtccttgttc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2765623 |
ttgtcaacaagtgtccttgttc |
2765644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 193
Target Start/End: Original strand, 11703519 - 11703574
Alignment:
| Q |
138 |
gtgaggactgtggcaggatcaaagacctcccaagtgtattgctcattgtattttgg |
193 |
Q |
| |
|
||||| ||||| || |||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
11703519 |
gtgagaactgtagctggatcaaaaacttcccatgtgtattgctcattgtattttgg |
11703574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University