View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_high_17 (Length: 214)
Name: NF10053_high_17
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10053_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 3959658 - 3959848
Alignment:
Q |
16 |
caatgaggtggtccagaatttttcgttcattcatgtttggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaa |
115 |
Q |
|
|
|||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
3959658 |
caatgatgtggtccagaattttttgttcattcatgtatggaaacccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagcaaa |
3959757 |
T |
 |
Q |
116 |
acattggtttcaaaattattttggtacatatatatgccctttatcgttggtgaaacttatagagtaaatatatcccttcttctctgctcct |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
T |
3959758 |
acattggtttcaaaattattttggtacatatatatgccctttatcgttggtgaaacttatatagtaaatatatcccttcttttctgctcct |
3959848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 118
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
Q |
53 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
118 |
Q |
|
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University