View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_high_18 (Length: 212)
Name: NF10053_high_18
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10053_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 24263212 - 24263036
Alignment:
| Q |
20 |
tatgttacaagttgtttttcataaactatcaagtagattaatatgtcgatagataagctaagataagtcatttcaaacatgtcataaagtaaataattga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263212 |
tatgttacaagttgtttttcataaactatcaagtagattaatatgtcgatagataagctcagataagtcatttcaaacatgtcataaagtaaataattga |
24263113 |
T |
 |
| Q |
120 |
ccttgtgaaatcatgttaggaacctggtgtcaaaagtggtgttgctccaaagaacactaaatctaccaccaaagtta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263112 |
ccttgtgaaatcatgttaggaacctggtgtcaaaagtggtgttgctccaaagaacactaaatctaccaccaaagtta |
24263036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University