View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_low_15 (Length: 261)
Name: NF10053_low_15
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10053_low_15 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 38324003 - 38324250
Alignment:
Q |
11 |
gttggactaagggctcccatggtggttgtcgttggtttgaccggaatagtaaaatttaaaaaactttttgtaatcagttggtcattttatcggttgttaa |
110 |
Q |
|
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38324003 |
gttggactaagggctccgatggt---tgtcgttggtttgaccggaatagtaaaatttaaaaaactttttgtaatcagttggtcattttatcggttgttaa |
38324099 |
T |
 |
Q |
111 |
aaactttaaattgattgttctgtttattggaaacaagtgttgttgcttctatgtggttggaggttactgataaggcgggcaatggaatgtgtatccaatt |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38324100 |
aaactttaaattgattgttctgtttattggaaacaagtgttgttgcttctctgtggttggaggttactgataaggcgggcaatggaatgtgtatccaatt |
38324199 |
T |
 |
Q |
211 |
tggtaaagttttgattttttaagagaaaaggtgtattgctgttgcggagat |
261 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38324200 |
tggtaaagttttgattttttaagagaaaaggtgtattgctgttgcggagat |
38324250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University