View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_low_19 (Length: 242)
Name: NF10053_low_19
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10053_low_19 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 38868849 - 38868625
Alignment:
| Q |
18 |
acatctatgatactcaagactattatgccctaaataatgaacccattatttgtctgagcaaggtgctttgtgaatgtggcacataataacaagcttatat |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868849 |
acatatatgatactcaagactattatgccctaaacaatgaacccattatttgtctgagcaaggtgctttgtgaatgtggcacataataacaagcttatat |
38868750 |
T |
 |
| Q |
118 |
agatcctttttcgtcttttaatgcattgtgatcataaagacaagatcatgtgatgtgaagcagctagcatgttgtgcctctttcggtggcatctcgtgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868749 |
agatcctttttcgtcttttaatgcattgtgatcataaagacaagatcatgtgatgtgaagcagctagcatgttgtgcctctttcggtggcatctcgtgaa |
38868650 |
T |
 |
| Q |
218 |
tacttcctataaaattggatggtcc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38868649 |
tacttcctataaaattggatggtcc |
38868625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 224
Target Start/End: Complemental strand, 38869102 - 38869064
Alignment:
| Q |
186 |
atgttgtgcctctttcggtggcatctcgtgaatacttcc |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38869102 |
atgttgtgcctctttcggtggcttctcgtgaatacttcc |
38869064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University