View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_low_20 (Length: 241)
Name: NF10053_low_20
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10053_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 12122935 - 12123159
Alignment:
| Q |
1 |
ataaatccttgacatggatttaaattgcggtctacaaccgcggttgcaatataaatgattctgaattttccgcaatagtaacacaactgcaatttcaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122935 |
ataaatccttgacatggatttaaattgcggtctacaaccgcagttgcaatataaatgattctgaattttccgcaatagtaacacaactgcaatttcaacc |
12123034 |
T |
|
| Q |
101 |
gtatcgaccatgtttttcgacaaattaaaatcatcatcccggataatacaatacacatgtatatcatgcatgctatgtagtatgctagtagcaattcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12123035 |
gtatcgaccatgtttttcgacaaattaaaatcatcatcccggataatacaatacacatgtatatcatgcatgctatgtagtatgctagtagcaattcttg |
12123134 |
T |
|
| Q |
201 |
attttcatgtgtttcctttgagctg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
12123135 |
attttcatgtgtttcctttgagctg |
12123159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University