View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_low_21 (Length: 241)
Name: NF10053_low_21
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10053_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43953635 - 43953413
Alignment:
| Q |
1 |
tgttaaactttagaaaataccttatatgatgattttattaagnnnnnnnncttcttctcagggatgatgattttattagtgatcaattcatgttaactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953635 |
tgttaaactttagaaaataccttatatgatgattttatta-gttttttttcttcttctcagggatgatgattttattagtgatcaattcatgttaactca |
43953537 |
T |
 |
| Q |
101 |
--atatttttgaatgaattattacactagctagcctctcctctgatttatgatactcatacgaacaccctttcaagtttcgtccatctaacgatttattc |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953536 |
caatatttttgaatgaatta---cactagctagcctctcctctgatttatgatactcatacgaacaccctttcaagtttcgtccatctaacgatttattc |
43953440 |
T |
 |
| Q |
199 |
ccttggaaccttgaaaagttcgcttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43953439 |
ccttggaaccttgaaaagttcgcttct |
43953413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University