View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10053_low_24 (Length: 229)
Name: NF10053_low_24
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10053_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 39144085 - 39144227
Alignment:
| Q |
7 |
tatgttgcagactattgatgataatagcattgagcaaagggtcttgctaacaatgcactaaatgcatcattttccagacaaagtttcaaaaatagaaata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39144085 |
tatgttgcagactattgatgataatagcagtgtgcaaagggtcttgctaacaatgcactaaatgcatcattttcaagacaaagtttcaaaaatagaaata |
39144184 |
T |
 |
| Q |
107 |
attggtaaattttaactatttaaagaaaaatagttccaatgca |
149 |
Q |
| |
|
|| ||| ||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
39144185 |
atcggtgaatttcaactatttaaagaaaactagttccaatgca |
39144227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University