View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10055_high_10 (Length: 240)

Name: NF10055_high_10
Description: NF10055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10055_high_10
NF10055_high_10
[»] chr1 (1 HSPs)
chr1 (16-222)||(46783590-46783796)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 46783590 - 46783796
Alignment:
16 gacgttggctagggagcagggtgattaagattggaagaggaacaatacacttgccatggttattggtttatgaccatcaccccttttttcttatttaatt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46783590 gacgttggctagggagcagggtgattaagattggaagaggaacaatacacttgccatggttattggtttatgaccatcaccccttttttcttatttaatt 46783689  T
116 tgcaatatgtattaaaagctaggcaagaacctagctttagtctttttcttcgtggcagttgcattttgctataacacatgtctttataattccatgaata 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
46783690 tgcaatatgtattaaaagctaggcaagaacctagctttagtctttttcttcgtgacagttgcattttgctataacacatgtctttataattccatgaata 46783789  T
216 accccaa 222  Q
    |||||||    
46783790 accccaa 46783796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University