View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10055_low_10 (Length: 240)
Name: NF10055_low_10
Description: NF10055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10055_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 46783590 - 46783796
Alignment:
Q |
16 |
gacgttggctagggagcagggtgattaagattggaagaggaacaatacacttgccatggttattggtttatgaccatcaccccttttttcttatttaatt |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46783590 |
gacgttggctagggagcagggtgattaagattggaagaggaacaatacacttgccatggttattggtttatgaccatcaccccttttttcttatttaatt |
46783689 |
T |
 |
Q |
116 |
tgcaatatgtattaaaagctaggcaagaacctagctttagtctttttcttcgtggcagttgcattttgctataacacatgtctttataattccatgaata |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46783690 |
tgcaatatgtattaaaagctaggcaagaacctagctttagtctttttcttcgtgacagttgcattttgctataacacatgtctttataattccatgaata |
46783789 |
T |
 |
Q |
216 |
accccaa |
222 |
Q |
|
|
||||||| |
|
|
T |
46783790 |
accccaa |
46783796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University