View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10055_low_11 (Length: 219)

Name: NF10055_low_11
Description: NF10055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10055_low_11
NF10055_low_11
[»] chr6 (1 HSPs)
chr6 (16-203)||(162063-162253)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 162063 - 162253
Alignment:
16 agaggttaatgaaggggtctttcatatttagtgtgtgtttggtttggaatttctgatgtactatttagccgcagaatgagaagttaggaatttcaacttc 115  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
162063 agaggttaatggaggggtctttcatatttagtgtgtgtttggtttggaatttctgatgtactatttagccgcagaatgagaagttaggaatttcaacttc 162162  T
116 actccata--tgtgttta-ccctgctaaccccctacagaaccttagattgtgatttttggatctgacaaacttgcttttgtgggtcaatac 203  Q
    ||||||||  |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
162163 actccatatgtgtgtttagccctgctaacaccctacagaaccttagattgtgatttttggatctgacaaacttgcttttgtgggtcaatac 162253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University