View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10055_low_11 (Length: 219)
Name: NF10055_low_11
Description: NF10055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10055_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 162063 - 162253
Alignment:
| Q |
16 |
agaggttaatgaaggggtctttcatatttagtgtgtgtttggtttggaatttctgatgtactatttagccgcagaatgagaagttaggaatttcaacttc |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162063 |
agaggttaatggaggggtctttcatatttagtgtgtgtttggtttggaatttctgatgtactatttagccgcagaatgagaagttaggaatttcaacttc |
162162 |
T |
|
| Q |
116 |
actccata--tgtgttta-ccctgctaaccccctacagaaccttagattgtgatttttggatctgacaaacttgcttttgtgggtcaatac |
203 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162163 |
actccatatgtgtgtttagccctgctaacaccctacagaaccttagattgtgatttttggatctgacaaacttgcttttgtgggtcaatac |
162253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University