View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10055_low_7 (Length: 302)
Name: NF10055_low_7
Description: NF10055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10055_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 25 - 243
Target Start/End: Original strand, 13049248 - 13049465
Alignment:
| Q |
25 |
gaccatgtgatggaaattaattgctgaagcacttggaaaatattactaccttaggtaccctcttatatttatgtactgaaagttactgtcatgtattgtg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049248 |
gaccatgtgatggaaattaattgctgaagcacttggaaaattttactaccttaggtaccctcttatatttatgtactgaaagttactgtcatgtattgtg |
13049347 |
T |
 |
| Q |
125 |
ggctaacatttttacgattattacagttatttagtttcctaatttgcatttgattccattttttaatgcatcagagcgtgttttgaattctgtcacttta |
224 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049348 |
g-ctaacatttttacgattattacagttatttagtttcctaatttgcatttgattccattttttaatgcatcagagcgtgttttgaattctgtcacttta |
13049446 |
T |
 |
| Q |
225 |
tctacatgatttggacttt |
243 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13049447 |
tctacatgatttggacttt |
13049465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 253 - 291
Target Start/End: Original strand, 13049502 - 13049540
Alignment:
| Q |
253 |
attatttgtctaattactgtgtaaatatttttcccctat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049502 |
attatttgtctaattactgtgtaaatatttttcccctat |
13049540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University