View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_high_9 (Length: 359)
Name: NF10056_high_9
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10056_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 1472884 - 1472693
Alignment:
| Q |
7 |
agcataggaaaacacatcttccataacagaaataagggaaaataaaccattaatccctatagtttcattttatttggattttgatccttaatag-----n |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1472884 |
agcataggaaaacacatcttccataacagaaataagggaaaataaacaattaatccctatagtttcattttatttggattttgatccttaatagtttttt |
1472785 |
T |
 |
| Q |
102 |
nnnnnnngagtaagtatacctttattcattgtgctaggggatagttgttaaacaaacatgatagaattttctgtctatgacaaaatgttttc |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1472784 |
tttttttgagtaagtatacctttatccattgtgctaggggatagttgttaaacaaacatgatagaattttctgtctatgacaacatgttttc |
1472693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 1472609 - 1472542
Alignment:
| Q |
277 |
ttcaacagaaagaaccttcaacttacatcaaccatgcttgatgttacaatcgctggtaagggttttgt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1472609 |
ttcaacagaaagaaccttcaacttacatcaaccatgcttgatgttacaatcgctggtaagggttttgt |
1472542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University