View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_low_21 (Length: 298)
Name: NF10056_low_21
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10056_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 130 - 284
Target Start/End: Original strand, 37914451 - 37914605
Alignment:
Q |
130 |
ataagtcaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt |
229 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37914451 |
ataagttaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt |
37914550 |
T |
 |
Q |
230 |
tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc |
284 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37914551 |
tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc |
37914605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University