View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_low_25 (Length: 289)
Name: NF10056_low_25
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10056_low_25 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 65 - 289
Target Start/End: Original strand, 41734261 - 41734485
Alignment:
| Q |
65 |
cgttgaggataaccttgatgaaatagaagcaactctagctaggttaaaaaaggagttaggcttatagaacacaatgatagctggttgaagaggaaatgcc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734261 |
cgttgaggataaccttgatgaaatagaagcaactctagctaggttaaaaaaggagttaggcttatagaacacaatgatagctggttgaagaggaaatgcc |
41734360 |
T |
|
| Q |
165 |
aatttattgcttctcatttatttatcttttggtggctcttgtaaatttgagtcaccaaattgaaaagtaaatatgtaatttagtccttgaaattgtagga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734361 |
aatttattgcttctcatttatttatcttttggtggctcttgtaaatttgagtcaccaaattgaaaagtaaatatgtaatttagtccttgaaattgtagga |
41734460 |
T |
|
| Q |
265 |
ctgtatcaatatagtcttccatata |
289 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41734461 |
ctgtatcaatatagtcttccatata |
41734485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 48
Target Start/End: Original strand, 41734224 - 41734259
Alignment:
| Q |
13 |
cagagacaccaagcaacagcactcaaggtggagcta |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41734224 |
cagagacaccaagtaacagcactcaaggtggagcta |
41734259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University