View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_low_27 (Length: 261)
Name: NF10056_low_27
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10056_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 168 - 249
Target Start/End: Complemental strand, 53126165 - 53126084
Alignment:
Q |
168 |
aagtagaggacaactagtttgatatgatgtctattgtgttatacgatatatcattgtgattttggcaataatctggcctttg |
249 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
T |
53126165 |
aagtagaggacaactagtttgatatgatgtctattgtgttatacgatatatcatagtgattttagcaataatctggcctttg |
53126084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 22 - 121
Target Start/End: Complemental strand, 53126262 - 53126163
Alignment:
Q |
22 |
ttggtccaagaaagttgatgtgtttgatttaaattttggaccatatagatcagcnnnnnnnngaccaatttttgcttatatattgagacatgcatggaag |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
T |
53126262 |
ttggtccaagaaagttgatgtgtttgatttaaattttggaccatatagatcaacttttttttgaccaatttttgcttatatattgagacatgcatggaag |
53126163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University