View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_low_30 (Length: 248)
Name: NF10056_low_30
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10056_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 51938059 - 51938287
Alignment:
Q |
19 |
gttgatgatctgataggagtgttaggagttgactt---------cttcttctgtagagaatgaagttcgtgaattgtttgggctttcaccgatgggctgc |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51938059 |
gttgatgatctgataggagtgttaggagttgacttgttgttcttcttcttctgtagagaatgaagttcgtgaattgtttgggctttcaccgatgggctgc |
51938158 |
T |
 |
Q |
110 |
tgtcgtcgtgacatatctccgaagaatccataactttcttgtgggtttggatcatgggtagcccacgacgcccaacaacgttgtcaatagttgttccatt |
209 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51938159 |
tgtcgtcgtgacatatctctgaagaatccataactttcttgtgggtttggatcatgggtagcccacgacgcccaacaacgttgtcaatagttgttccatt |
51938258 |
T |
 |
Q |
210 |
tctgaaatctgatccattcttctcctttg |
238 |
Q |
|
|
|||||||||||||||||||||||| |||| |
|
|
T |
51938259 |
tctgaaatctgatccattcttctcttttg |
51938287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University