View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10056_low_39 (Length: 204)
Name: NF10056_low_39
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10056_low_39 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 1763266 - 1763076
Alignment:
| Q |
1 |
ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763266 |
ttgcaaatctttccggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg |
1763167 |
T |
|
| Q |
101 |
aatttggatacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763166 |
aatttggatacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc |
1763076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 10523 - 10409
Alignment:
| Q |
1 |
ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg |
100 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| ||||||| || ||| || ||||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
10523 |
ttgcaaatctttcaggattgaactcgtgtgcatcggccccccaaatatcaatgtcatgctgcaatattgggattggaatctgaatattcattccttttgg |
10424 |
T |
|
| Q |
101 |
aatttggataccttt |
115 |
Q |
| |
|
|| || ||||||||| |
|
|
| T |
10423 |
aactttgataccttt |
10409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 10369 - 10333
Alignment:
| Q |
155 |
tgctggtggataaagcctcaatgtctcttgaatcacc |
191 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10369 |
tgctggcggataaagcctcaaagtctcttgaatcacc |
10333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 19208109 - 19208073
Alignment:
| Q |
155 |
tgctggtggataaagcctcaatgtctcttgaatcacc |
191 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19208109 |
tgctggtggataaagcctcaaagtctcttgaatcacc |
19208073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 19208263 - 19208135
Alignment:
| Q |
1 |
ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg |
100 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| | ||||| | || |||||| |||||||| | |||||||| || | ||| ||||||||||| |
|
|
| T |
19208263 |
ttgcaaatctttcaggattgaactcgtgtgcatcgggcccccagatatcaatgtcttgttgcaatatcgcaattggaatctgcatattaattccttttgg |
19208164 |
T |
|
| Q |
101 |
aatttggatacctttgaaattaatgtctt |
129 |
Q |
| |
|
|| || ||||||||| |||||||| |||| |
|
|
| T |
19208163 |
aactttgataccttttaaattaatatctt |
19208135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University