View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10056_low_39 (Length: 204)

Name: NF10056_low_39
Description: NF10056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10056_low_39
NF10056_low_39
[»] chr8 (1 HSPs)
chr8 (1-191)||(1763076-1763266)
[»] scaffold0147 (2 HSPs)
scaffold0147 (1-115)||(10409-10523)
scaffold0147 (155-191)||(10333-10369)
[»] chr7 (2 HSPs)
chr7 (155-191)||(19208073-19208109)
chr7 (1-129)||(19208135-19208263)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 1763266 - 1763076
Alignment:
1 ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1763266 ttgcaaatctttccggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg 1763167  T
101 aatttggatacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1763166 aatttggatacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc 1763076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0147 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0147
Description:

Target: scaffold0147; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 10523 - 10409
Alignment:
1 ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg 100  Q
    ||||||||||||| ||||||||||  ||||||||    |||||||  ||   ||| || ||||||||||| |||||||| |||| |||||||||||||||    
10523 ttgcaaatctttcaggattgaactcgtgtgcatcggccccccaaatatcaatgtcatgctgcaatattgggattggaatctgaatattcattccttttgg 10424  T
101 aatttggataccttt 115  Q
    || || |||||||||    
10423 aactttgataccttt 10409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0147; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 10369 - 10333
Alignment:
155 tgctggtggataaagcctcaatgtctcttgaatcacc 191  Q
    |||||| |||||||||||||| |||||||||||||||    
10369 tgctggcggataaagcctcaaagtctcttgaatcacc 10333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 19208109 - 19208073
Alignment:
155 tgctggtggataaagcctcaatgtctcttgaatcacc 191  Q
    ||||||||||||||||||||| |||||||||||||||    
19208109 tgctggtggataaagcctcaaagtctcttgaatcacc 19208073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 19208263 - 19208135
Alignment:
1 ttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttgg 100  Q
    ||||||||||||| ||||||||||  ||||||||  | ||||| |  ||   |||||| |||||||| |  |||||||| || | ||| |||||||||||    
19208263 ttgcaaatctttcaggattgaactcgtgtgcatcgggcccccagatatcaatgtcttgttgcaatatcgcaattggaatctgcatattaattccttttgg 19208164  T
101 aatttggatacctttgaaattaatgtctt 129  Q
    || || ||||||||| |||||||| ||||    
19208163 aactttgataccttttaaattaatatctt 19208135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University