View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10057_high_11 (Length: 228)
Name: NF10057_high_11
Description: NF10057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10057_high_11 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 3376519 - 3376297
Alignment:
| Q |
6 |
gttgcaatgacaatatcccttttgcttggaactcacacaacccataatcacaaatatgaaaatgatcaacacacaaagtgaatctcacaatgaaaaaacc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3376519 |
gttgcaatgacaatatcccttttgcttggaacttacacaacccataatcacaaatatgaaaatgatcaacacacaaagtgaatctcacaatgaaaaaacc |
3376420 |
T |
|
| Q |
106 |
aagtttgagaatttgatttatgaaatcaaaaacaccccacaaataaaaaagaatttgtcagaaattcttgtccactcaaagtgctttcaagatcaaacaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3376419 |
aagtttgagaatttgatttatgaaatcaaaaacaccccacaaataaaaaagaatttgtcagaaattcttgtccactcaaagtgctttcaagatcaaacaa |
3376320 |
T |
|
| Q |
206 |
aaacaaaatgtcaagtgaaaatt |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3376319 |
aaacaaaatgtcaagtgaaaatt |
3376297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University