View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10057_low_11 (Length: 261)
Name: NF10057_low_11
Description: NF10057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10057_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40514036 - 40513807
Alignment:
| Q |
1 |
tgttatctagattcatagttttggtcgaagagaaatttgattcttttggaaaaccagtatgggatttgataatccaagacctgaaaggtgtgtgtttcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
40514036 |
tgttatctagattcatagttttggtcgaagagaaatttgattcttttggaaaaccagtatgggatttgataatccaagatctgaaaggt--gtgtttcct |
40513939 |
T |
 |
| Q |
101 |
aaattccctcaaataattttcaaaattccaagttatttag--ctaattagtcttcaagtttatgaacttttcatattatttttcataggtttgaagatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40513938 |
aaattccctcaaataattttcaaaattccaagttatttagtactaattagtcttcaagtttatgaac------------ttttcataggtttgaagatga |
40513851 |
T |
 |
| Q |
199 |
tcctgaaatatcaaaaattcccacaacaagtggagttaaggtga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513850 |
tcctgaaatatcaaaaattcccacaacaagtggagttaaggtga |
40513807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University