View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10057_low_13 (Length: 245)
Name: NF10057_low_13
Description: NF10057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10057_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 50157266 - 50157066
Alignment:
| Q |
16 |
caacaaagaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaaccgagacagtgccttggagatcataattgcttgattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50157266 |
caacaaagaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaactgagacagtgccttggagattataattgcttgattt |
50157167 |
T |
|
| Q |
116 |
cgattaaataattgaactcagttacagtaaaagtgacgagttttcaagttatgtatagaagacttttggataacaatgtaccagtgaatatgctgctcgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157166 |
cgattaaataattgaactcagttacagtaaaagtgacgagtgttcaagttatgtatagaatacttttggataacaatgtaccagtgaatatgctgctcgg |
50157067 |
T |
|
| Q |
216 |
c |
216 |
Q |
| |
|
| |
|
|
| T |
50157066 |
c |
50157066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University