View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10057_low_16 (Length: 218)
Name: NF10057_low_16
Description: NF10057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10057_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 24368825 - 24369034
Alignment:
Q |
1 |
tttacatgtaaacaccagtcatactgcccaaaatgacgtggcctacatggatcagtcttgaccaatcattcacgcgagtaatgtgtcagtctttccactg |
100 |
Q |
|
|
|||||||||||| |||| |||||||| ||||||||| |||| |||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
T |
24368825 |
tttacatgtaaataccaatcatactgtccaaaatgatgtggactacgtggatcagtcttgaccaatcattcacgtgagtaatgtgttagtctttccactc |
24368924 |
T |
 |
Q |
101 |
tgagggatccatgacaccccac-----acttgcattttttcacttcgctgcatgatccgttgacaaagtccacatgtgtgtaagtctccactcaatgtgc |
195 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| | || |
|
|
T |
24368925 |
tgagggatccatgacaccccacgtttgacttgcattttttcacttcgctgcatgatccgttgacaaagttcacatgtgtgtaagtctctactcaacgcgc |
24369024 |
T |
 |
Q |
196 |
ctctgtgctc |
205 |
Q |
|
|
|||||||||| |
|
|
T |
24369025 |
ctctgtgctc |
24369034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University