View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10058_high_7 (Length: 239)
Name: NF10058_high_7
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10058_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 7003041 - 7002808
Alignment:
| Q |
1 |
cccggaaatgacccgagttggttgacgcaatacggaggagacgccttagatcccgcgtagcggagtcatcaacggcaaccggcgcaaacttcctctgaaa |
100 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003041 |
cccggaaacgacccgatttggtttacgcaatacggaggagacgccttagatcccgcgtagcggagtcatcaacggcaaccggcgcaaacttcctctgaaa |
7002942 |
T |
|
| Q |
101 |
agaaggaataggaagagcactcggcgacggagacatcgcgaaagcggatccggcgtaaacatcacaaccggttttgaaatcaacgatccggatctgttta |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7002941 |
agaaggaataggaagagcgctcggcgacggagacatcgcgaaagcggatccggcgtaaacatcacaaccggttttgaaatcaacgatccggatctgttta |
7002842 |
T |
|
| Q |
201 |
ggaaccatattcgggtcgggtccaagtctctgtg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7002841 |
ggaaccatattcgggtcgggtccaagtctctgtg |
7002808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University