View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10058_high_8 (Length: 218)
Name: NF10058_high_8
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10058_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 129
Target Start/End: Original strand, 52392164 - 52392280
Alignment:
| Q |
13 |
atcagagaaggagaccgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctatcaactgttt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52392164 |
atcaaagaaggagaccgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctaccaactgttt |
52392263 |
T |
 |
| Q |
113 |
tgtttatgtgctaatga |
129 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52392264 |
tgtttatgtgctaatga |
52392280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 52392291 - 52392325
Alignment:
| Q |
166 |
ttgataattcaattcgatatttaattggacagccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52392291 |
ttgataattcaattcgatatttaattggacagccc |
52392325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 7116330 - 7116381
Alignment:
| Q |
29 |
gaggatgaacaccttacagctatttccaatttatcaaggactattcaggttt |
80 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
7116330 |
gaggaagaacaccttatagcaatttccaatttgtcaaagactattcaggttt |
7116381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University