View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10058_high_8 (Length: 218)

Name: NF10058_high_8
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10058_high_8
NF10058_high_8
[»] chr3 (2 HSPs)
chr3 (13-129)||(52392164-52392280)
chr3 (166-200)||(52392291-52392325)
[»] chr1 (1 HSPs)
chr1 (29-80)||(7116330-7116381)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 129
Target Start/End: Original strand, 52392164 - 52392280
Alignment:
Q  13 atcagagaaggagaccgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctatcaactgttt 112  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  52392164 atcaaagaaggagaccgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctaccaactgttt 52392263  T
Q  113 tgtttatgtgctaatga 129  Q
    |||||||||||||||||    
T  52392264 tgtttatgtgctaatga 52392280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 52392291 - 52392325
Alignment:
Q  166 ttgataattcaattcgatatttaattggacagccc 200  Q
    |||||||||||||||||||||||||||||||||||    
T  52392291 ttgataattcaattcgatatttaattggacagccc 52392325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 7116330 - 7116381
Alignment:
Q  29 gaggatgaacaccttacagctatttccaatttatcaaggactattcaggttt 80  Q
    ||||| |||||||||| ||| ||||||||||| |||| ||||||||||||||    
T  7116330 gaggaagaacaccttatagcaatttccaatttgtcaaagactattcaggttt 7116381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University