View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10058_low_12 (Length: 235)
Name: NF10058_low_12
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10058_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 48250061 - 48249888
Alignment:
| Q |
16 |
agaggagggaaatcagtgaaaaaacaatgggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48250061 |
agaggagggaaatcagtgaaaaaacaatgggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctga |
48249962 |
T |
|
| Q |
116 |
atcagagatctgatagtgaggctttctcagcttcatctcagtcttttgcaagagcagttggcgatggaccggat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48249961 |
atcagagatctgatagtgaggctttctcagcttcatctcagtcttttgcaagagcagttggcgatgggccggat |
48249888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University