View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10058_low_13 (Length: 226)
Name: NF10058_low_13
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10058_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 210
Target Start/End: Original strand, 50463658 - 50463855
Alignment:
| Q |
13 |
tttggtgtttctatattaatgttgtctgtttggtcaaaaaacacagaattaaccgttttgaatatgtgatcatcagcagcagaagcagaagcagcaccaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50463658 |
tttggtgtttctatattaatgttgtctgtttggtcaaaaaacacagaattaaccgttttgaatatgtgatcatcagcagcagaagtagaagcagcaccaa |
50463757 |
T |
|
| Q |
113 |
ctcgaaaagaaagagtttttggatgggcacaagagggtaagaattgccatggatgttgttttctttgtgaaatttctttggttttgaaaagagaaggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50463758 |
ctcgaaaagaaagagtttttggatggccacaagagggtaagaattgccatggatgttgttttctttgtgaaatttctttggttttgaaaagagaaggt |
50463855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University