View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10058_low_8 (Length: 307)
Name: NF10058_low_8
Description: NF10058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10058_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 10162410 - 10162619
Alignment:
| Q |
18 |
gttcatcctcctatgacaatcacttcttttcaaaactatattctatgtttacaatcacttcttttcattgtcctcgcttgatgaactaacgatggatgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10162410 |
gttcatcctcctatgacaatcacttcttttcaaaactatattctatgtttacaatcacttcttttcattgtcctcgcttgatgaactaacgatggatgtg |
10162509 |
T |
 |
| Q |
118 |
gaaactcagaattcggattcagagtttccgttttggaaacccgattcacccttcttcgccatcggtaacctcaaatgaaaacttcttgtcaaacaggtac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10162510 |
gaaactcagaattcggattcagagtttccgttttggaaacccgattcacccttcttcgccatcggtaacctcaaatgaaaacttcttgtcaaacaggtac |
10162609 |
T |
 |
| Q |
218 |
ttattttatc |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
10162610 |
ttattttatc |
10162619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 155 - 224
Target Start/End: Original strand, 10183561 - 10183630
Alignment:
| Q |
155 |
aacccgattcacccttcttcgccatcggtaacctcaaatgaaaacttcttgtcaaacaggtacttatttt |
224 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||| || || ||||||||||||||||||| |||||||| |
|
|
| T |
10183561 |
aacctgattcacctttcttcgctatcggtaacctcgaacgagaacttcttgtcaaacaggttcttatttt |
10183630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University