View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10059_high_4 (Length: 212)
Name: NF10059_high_4
Description: NF10059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10059_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 56098895 - 56098713
Alignment:
Q |
20 |
atgaagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaattttgcgcatgatccttatca |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
56098895 |
atgaagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaatcttgcgcatgatccttatca |
56098796 |
T |
 |
Q |
120 |
catttgcaattggcataaaacggtcttgttccctcacaatgcattcattgtcttgttctgttccattgttgttctgtgctcct |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
56098795 |
catttgcaattggcataaaacggtcttgttccctcacaatgcattcattgtcttgttctgtaccattgttgttctgttctcct |
56098713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University