View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10059_low_5 (Length: 241)
Name: NF10059_low_5
Description: NF10059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10059_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 3 - 153
Target Start/End: Complemental strand, 3705208 - 3705058
Alignment:
| Q |
3 |
agatggaattttaccacctatatacaatcctactcaacttgagggttgtaacttgcgagttccaacgactagagcggtgaaatacctctttcaatagcat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705208 |
agatggaattttaccacctatatacaatcctactcaacttgagtgttgtaacttgcgagttccaacgactagagcggtgaaatacctctttcaatagcat |
3705109 |
T |
 |
| Q |
103 |
acaatatggtttgtgcttgtacattgaggggttgtgtttcgatgatagtta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705108 |
acaatatggtttgtgcttgtacattgaggggttgtgtttcgatgatagtta |
3705058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 3705048 - 3705010
Alignment:
| Q |
185 |
gaggatgttatcagtttgtagcaggagccacttaacagc |
223 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3705048 |
gaggctgttatcagtttgtagcaggagccacttaacagc |
3705010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University