View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10059_low_6 (Length: 240)
Name: NF10059_low_6
Description: NF10059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10059_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 11408290 - 11408084
Alignment:
| Q |
19 |
gctgcgccagccacaaccacaacgagagttgcaaagaaaaacagaaacctaatcgagttcattgtgatgtagtgaatcagttgagaattgttgtgagggg |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11408290 |
gctgtgccagccacaaccacaacgagagttgcaaagaaaaaaagaatcctaatcgagttcattgtgatgtagtgaatcagttgagaattgttgtgaggga |
11408191 |
T |
 |
| Q |
119 |
tagtgagggagaaagaagtgaatcagttatgaggagcaagaattgaagaatgaagtattcaatgggaatgtgatttgaaagaagaagaattatatatata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11408190 |
tagtgagggagaaagaagtgaatcagttatgaggagcaagaattgaagaatgaagaattcaatgggaatgtgatttgaaagaagaagaattatatatata |
11408091 |
T |
 |
| Q |
219 |
gcaacac |
225 |
Q |
| |
|
||||||| |
|
|
| T |
11408090 |
gcaacac |
11408084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University