View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_high_12 (Length: 240)
Name: NF10060_high_12
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10060_high_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 3981160 - 3981383
Alignment:
| Q |
17 |
aagaatcccacctacattcggctccttagtgtccaacttcttcctattctttcgtgaaacctctctcgggtcatatcccgaggttcttataacaagttag |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||| |||||||||| ||||||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
3981160 |
aagaatcccacctacattcggctccctagtgcccaacttctttgtattctttcgggaaacctatcttgggtcatatcccgaggttcttatggcaagttaa |
3981259 |
T |
|
| Q |
117 |
ttttgatattcttgacctcagcgggaatgaattgaagagtgacgcttcttttctatttggggagaataaaacaaacactcagatcctcaacttgttgtgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3981260 |
ttttgatattcttgacctcagcgggaatgaattgaagagtgacgcttcttttctatttggggagaataaaacaaacactcagatcctcaacttgtcgtgc |
3981359 |
T |
|
| Q |
217 |
aaccacttgtcgtttgatctgact |
240 |
Q |
| |
|
|| ||||||| ||||||||||||| |
|
|
| T |
3981360 |
aatcacttgttgtttgatctgact |
3981383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University