View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_high_16 (Length: 216)
Name: NF10060_high_16
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10060_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 3981619 - 3981405
Alignment:
Q |
1 |
tttttcaatctaattcaaagatcaaatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat |
100 |
Q |
|
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3981619 |
ttttgcaatctaattcaaagatcacatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat |
3981520 |
T |
 |
Q |
101 |
aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggacgacaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
3981519 |
aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggatgacaa |
3981420 |
T |
 |
Q |
201 |
gatcgggatatcttc |
215 |
Q |
|
|
||||||||||||||| |
|
|
T |
3981419 |
gatcgggatatcttc |
3981405 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University