View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_high_8 (Length: 285)
Name: NF10060_high_8
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10060_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 49766640 - 49766414
Alignment:
| Q |
1 |
gtagcaaatcaactgcaacaccaagaagaggtagtaactctatggttgatgcagatgatgaatattttagtccaagaaaaagaaatgggttttggtcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766640 |
gtagcaaatcaactgcaacaccaagaagaggtagtaactctatggttgatgcagatgatgaatattttagtccaagaaaaagaaatgggttttggtcttt |
49766541 |
T |
 |
| Q |
101 |
tctctatcattcttcaaaatcttcaacttcttccaagagctttagtaatactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttcttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766540 |
tctctatcattcttcaaaatcttcaacttcttccaagagctttagtaatactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttcttta |
49766441 |
T |
 |
| Q |
201 |
ggaagaaagaacgacattgttattgtt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49766440 |
ggaagaaagaacgacattgttattgtt |
49766414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 245 - 275
Target Start/End: Complemental strand, 49766396 - 49766366
Alignment:
| Q |
245 |
taacagtcctaatagcaacaacacaggttct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49766396 |
taacagtcctaatagcaacaacacaggttct |
49766366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University