View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_high_9 (Length: 261)
Name: NF10060_high_9
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10060_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 162 - 243
Target Start/End: Complemental strand, 44380948 - 44380867
Alignment:
| Q |
162 |
gtgttgggtgaagattcattcctaagtctcttgcaatggttgcaagtttatatgtgtttgttatgatttcttgggttgggag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380948 |
gtgttgggtgaagattcattcctaagtctcttgcaatggttgcaagtttatatgtgtttgttatgatttcttgggttgggag |
44380867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 44381121 - 44381067
Alignment:
| Q |
1 |
atgtgtcaatggcgttgtggcaaaagaaggaaaaggaatcggaatggcgtggttt |
55 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
44381121 |
atgtgtcaatggcgttgtggaaaaagaaggaaaaggaatgggaacggcgtggttt |
44381067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University