View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_low_11 (Length: 330)
Name: NF10060_low_11
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10060_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 48065141 - 48064835
Alignment:
| Q |
1 |
agatcgaaccatgaattgttgcagtttaattgttaatttatttgtgtttctgttatggtgcagataattatcgaagaagagtattcttcaactacgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065141 |
agatcgaaccatgaattgttgcagtttaattgttaatttatttgtgtttctgttatggtgcagataattatcgaagaagagtattcttcaactacgaaaa |
48065042 |
T |
 |
| Q |
101 |
acgtcttcgcttgcaaagtcctccagaaaaggtaatcaatcttgtcattatgagtttgtttaatgatcaatcaatagcttaaaaccagcaaattgttacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065041 |
acgtcttcgcttgcaaagtcctccagaaaaggtaatcaatcttgtcattatgagtttgtttaatgatcaatcaatagcttaaaaccagcaaattgttacc |
48064942 |
T |
 |
| Q |
201 |
attgaatgttttaatatgacaccttgtttgattctaggtttttgagtactttgcatcgaatcggatccctggtggcgaggtttttatgacacctgcagat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48064941 |
attgaatgttttaatatgacaccttgtttgattctaggtttttgagtactttgcatcgaatcggatccctggtggcgaggtttttatgacacctgcagat |
48064842 |
T |
 |
| Q |
301 |
ttgatgc |
307 |
Q |
| |
|
||||||| |
|
|
| T |
48064841 |
ttgatgc |
48064835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University