View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_low_25 (Length: 223)
Name: NF10060_low_25
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10060_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 33226926 - 33227119
Alignment:
Q |
14 |
cataggtactccaaaactgaactttaatagattgatgtaaccatttttgtcatataatatcgttaatgagaattgaacttctgaccaacgtgcggagtat |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
33226926 |
cataggtactccaaaactgaactttaatagattgatgtaaccatttttgtcatataatatcgttaatgagaatcaaacttctgaccaacgtgcggagtat |
33227025 |
T |
 |
Q |
114 |
gacaccgaccaagtctcagaatccatatctattcctatacgagcaccggttcccacatatatttcctggtaatgattaagaaatcttccatttt |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33227026 |
gacaccgaccaagtctcagaatccatatctattcctatacgagcaccggttcccacatatatttcctggtaatgattaagaaatcttccatttt |
33227119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 32 - 131
Target Start/End: Original strand, 33223981 - 33224083
Alignment:
Q |
32 |
gaactttaatagattgatgtaaccattt---ttgtcatataatatcgttaatgagaattgaacttctgaccaacgtgcggagtatgacaccgaccaagtc |
128 |
Q |
|
|
||||||||| |||||||||| |||||| | ||||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||| ||||||||| |
|
|
T |
33223981 |
gaactttaagagattgatgtcaccattaacgtcgtcatataatatcattaatgagaaatgaacttctgataaacctgcggagtatgacacagaccaagtc |
33224080 |
T |
 |
Q |
129 |
tca |
131 |
Q |
|
|
||| |
|
|
T |
33224081 |
tca |
33224083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University