View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_low_26 (Length: 223)
Name: NF10060_low_26
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10060_low_26 |
 |  |
|
[»] scaffold0190 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 15745163 - 15745359
Alignment:
Q |
1 |
tttgtcccatgaaactttggaggcaattggtaatgatcctgagtttatggatgttgtgtccaactaatgttgcctctatagtgttatgcaaaagctttgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| || ||||||||||||||| ||| || |
|
|
T |
15745163 |
tttgtcccatgaaactttggaggcaattggtaatgatcccgagtttatgaatgttgtgtccaactaatgttgcttc--tagtgttatgcaaaaccttcgg |
15745260 |
T |
 |
Q |
101 |
tataccatttcagtttatctcctgtttggtttgtattttgtgttacccatgaattaataattatg-ttttttgtaggaaataattatgtt-atgtcttaa |
198 |
Q |
|
|
|||| |||||||||| |||||| |||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||| ||||||||| |
|
|
T |
15745261 |
tatatcatttcagttcatctccagtttggtttgtattttgtgttacccatg----aataattatgtttttttttaggaaataattatgttgatgtcttaa |
15745356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 4350 - 4292
Alignment:
Q |
10 |
tgaaactttggaggcaattggtaatgatcctgagtttatggatgttgtgtccaactaat |
68 |
Q |
|
|
||||| ||||||||||||| | |||||||||||||||||||||||||||||| |||||| |
|
|
T |
4350 |
tgaaattttggaggcaattagaaatgatcctgagtttatggatgttgtgtcctactaat |
4292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 7628576 - 7628523
Alignment:
Q |
16 |
tttggaggcaattggtaatgatcctgagtttatggatgttgtgtccaactaatg |
69 |
Q |
|
|
|||||||||||| || ||||| ||| | ||| |||||||||||||||||||||| |
|
|
T |
7628576 |
tttggaggcaatgggaaatgaccctcaatttgtggatgttgtgtccaactaatg |
7628523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University