View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10060_low_27 (Length: 216)
Name: NF10060_low_27
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10060_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 3981619 - 3981405
Alignment:
| Q |
1 |
tttttcaatctaattcaaagatcaaatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat |
100 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981619 |
ttttgcaatctaattcaaagatcacatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat |
3981520 |
T |
 |
| Q |
101 |
aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggacgacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3981519 |
aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggatgacaa |
3981420 |
T |
 |
| Q |
201 |
gatcgggatatcttc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3981419 |
gatcgggatatcttc |
3981405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University