View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10061_low_14 (Length: 249)
Name: NF10061_low_14
Description: NF10061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10061_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 17733824 - 17733625
Alignment:
| Q |
1 |
acctaataactaattactatgaaacaagagaaaatactaacctaagttaccgtttttagatttttatcagatagagatcacccccgacttagtacgtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17733824 |
acctaataactaattactatgaaacaagagaaaatactaacctaagttaccgttgttagatttttatcagatagagatcacccccgacttagtacgtgag |
17733725 |
T |
|
| Q |
101 |
gacgttttaaatcgattgccataaaacatattcaaaatgatgcaaaatatcacactttgaaacaaccacatctgaataggttgaatcatctgacctatta |
200 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17733724 |
gacgttttaaatagattgtcataaaacatattcaaaacgatgcaaaatatcacactttgaaacaaccacatctgaacaggttgaatcatctgaccaatta |
17733625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University