View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10061_low_16 (Length: 238)
Name: NF10061_low_16
Description: NF10061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10061_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 29606797 - 29606590
Alignment:
| Q |
14 |
tttggtggtttagaagctggtggtaatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606797 |
tttggtggtttagaagctggtggtaatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtg |
29606698 |
T |
|
| Q |
114 |
gtggtggttgaattttaggggatggggtttttgggcttaatgccggtgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606697 |
gtggtggttgaattttaggggatggggtttttgggcttaatgccggtgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaac |
29606598 |
T |
|
| Q |
214 |
tggtgatt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
29606597 |
tggtgatt |
29606590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University