View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10061_low_17 (Length: 233)
Name: NF10061_low_17
Description: NF10061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10061_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 275675 - 275874
Alignment:
| Q |
19 |
aggggcgtgaaaattgtgatagccactggaaaagtaagatgttgtagacccatgatttgtcagaatagcatgttttaagctatttattttatactggcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
275675 |
aggggcgtgaaaattgtgatagccactggaaaagtaagatgttgtatacccgtgatttgtcagaataccatgttttaagctatttattttacactggcta |
275774 |
T |
 |
| Q |
119 |
atacaaatgtggatacaaaatgtcagaatactggtcaattattggttgttactgctgctattcttagcaatttttctaatataaatgtggatattcatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275775 |
atacaaatgtggatacaaaatgtcagaatactggtcaattattggttgttactgctgctattcttagcaatttttctaatataaatgtggatattcatat |
275874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University