View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10061_low_18 (Length: 230)
Name: NF10061_low_18
Description: NF10061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10061_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 25732354 - 25732143
Alignment:
| Q |
1 |
ggatggggaaggaagcaccgtcgagaagagcgatgactttagggtctggtgctatgaaaccacctggtggcatgttgagtttgaggacagtggaattgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25732354 |
ggatggggaaggaagcaccgtcgagaagagcgatgacttttgggtctggagcgatgaaaccacctggtggcatgttgagtttgaggacagtggagttgta |
25732255 |
T |
 |
| Q |
101 |
tttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtctgtcatggaggggtccgatgatgggaagaccgtagcttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25732254 |
tttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcatgtctgtcatggaggggtccgatgatgggaagaccgtagcttcct |
25732155 |
T |
 |
| Q |
201 |
gggattggtttc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25732154 |
gggattggtttc |
25732143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 62 - 159
Target Start/End: Complemental strand, 12490668 - 12490571
Alignment:
| Q |
62 |
acctggtggcatgttgagtttgaggacagtggaattgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtc |
159 |
Q |
| |
|
|||||||||||||||| | ||| || || || |||||||||| |||||| ||| |||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
12490668 |
acctggtggcatgttggttctgaagattgttgagttgtatttttggattcttgttgagaagaatttgtctcttccttggttgtagaagtagtcgtgtc |
12490571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University