View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10061_low_20 (Length: 228)
Name: NF10061_low_20
Description: NF10061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10061_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29116106 - 29116338
Alignment:
| Q |
1 |
tttcggttgcaatttcacacgcctcacttctaagcatgatcaaaatttgaattagtcaaatagcttactcacccctattatttatttctacaccatgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29116106 |
tttcggttgcaatttcacacgcctcact---aagcatgatcaaaatttgaattagtcaaatagcttactcacccctattatttatttctacaccatgtgg |
29116202 |
T |
 |
| Q |
101 |
tttaattaaataattaaatatcgaataaatctttatataccgtgtataaaatattagga--------------tgtaacaaatgtgattctgaacatgga |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29116203 |
tttaattaaataattaaatattgaataaatctttatacaacgtgtataaaatattaggatgttacaagccctttgtaacaaatgtgattctgaacatgga |
29116302 |
T |
 |
| Q |
187 |
atgtatgtcattaaagacaaaagcaaaggggtaatc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29116303 |
atgtatgtcattaaagacaaaagcaaaggggtaatc |
29116338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University