View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10062_high_3 (Length: 238)
Name: NF10062_high_3
Description: NF10062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10062_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 50921902 - 50921680
Alignment:
| Q |
1 |
tgcaggttataaaagagctaatatcactgcttgatcaacggaaagatgaatcaatagaacaaactttcaaaggtgttgctagccattttcgaaaagtatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50921902 |
tgcaggttataaaagagctaatatcactgcttgatcaacggaaagatgaatcagtagaacgaactttcaaaggtgttgctagccattttcgaagagtatt |
50921803 |
T |
 |
| Q |
101 |
ctctgagcttgtaaaggggggcaatgctgatctggttatgatgatgaagaagaaggtttgtggttatcaaataacgtcttagattctcccatcaattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50921802 |
ctctgagcttgtaaaggggggcaatgctgatctggttatgatgatgaagaagaaggtttgtggttatcaaataacgtcttagattctcccatcaattttt |
50921703 |
T |
 |
| Q |
201 |
gtgattgcattggataggaaaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50921702 |
gtgattgcattggataggaaaag |
50921680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 20743120 - 20743320
Alignment:
| Q |
14 |
agagctaatatcactgcttgatcaacggaaagatgaatcaatagaacaaactttcaaaggtgttgctagccattttcgaaaagtattctctgagcttgta |
113 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||||||||||| | |||||||||||||||||||| ||||| ||| ||||||||||||| |||||| |
|
|
| T |
20743120 |
agagctaatatcaagtctagatcaacggaaggatgaatcaatagagcgcactttcaaaggtgttgctaggcatttccgagaagtattctctgaacttgta |
20743219 |
T |
 |
| Q |
114 |
aaggggggcaatgctgatctggttatgatgatgaagaagaaggtttgtggttatcaaataacgtcttagattctcccatcaatttttgtgattgcattgg |
213 |
Q |
| |
|
|||||||| ||| | |||||||| ||||||||||||||||||||| | || || ||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20743220 |
caggggggccatggtcatctggtt---atgatgaagaagaaggtttgttgctagtaattaatgtcttagcttctcccatcaatttttgtgattgcattgg |
20743316 |
T |
 |
| Q |
214 |
atag |
217 |
Q |
| |
|
|||| |
|
|
| T |
20743317 |
atag |
20743320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University