View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10063_low_3 (Length: 250)

Name: NF10063_low_3
Description: NF10063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10063_low_3
NF10063_low_3
[»] chr2 (1 HSPs)
chr2 (5-236)||(17604472-17604705)
[»] scaffold0082 (1 HSPs)
scaffold0082 (1-189)||(14764-14952)
[»] chr1 (1 HSPs)
chr1 (92-189)||(37882354-37882451)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 17604705 - 17604472
Alignment:
5 agatcgagagtaattactattgataagacaaatatagggagggaggacaaagtaaatagtgatgcctctattaaattaattgattcatcatggtagcgaa 104  Q
    ||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||| || | ||||||||||||||||| |||||||||| |||    
17604705 agatcgagagtaattactattgatagggaaaatatagggagggaggacaaagtaaatagtgaggcttatattaaattaattgatttatcatggtagagaa 17604606  T
105 ggaaaacggcacacagaccgtactcaagcttcagatcaatgttcccataagcaaagagtatgcccgattgtttttaagagaacact--aaaagaaaacat 202  Q
    | ||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||  |||| |||||||    
17604605 gaaaaacggcacatagaccgtactcgagcttcagatcaatgtccccataagcaaagagtatgcccgattgtttttaagagaaaactacaaaaaaaaacat 17604506  T
203 attcacctcgattagagaagaattgctttacgcc 236  Q
    |||||||||||||||||| |||||||||||||||    
17604505 attcacctcgattagagacgaattgctttacgcc 17604472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0082 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold0082
Description:

Target: scaffold0082; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 14952 - 14764
Alignment:
1 cttcagatcgagagtaattactattgataagacaaatatagggagggaggacaaagtaaatagtgatgcctctattaaattaattgattcatcatggtag 100  Q
    |||| ||||| ||||||| |||| ||||| | |||| ||||||||| ||||||||| ||| || |||||||  ||||||| ||||||||| |||||||||    
14952 cttcggatcgggagtaatcactagtgatagggcaaaaatagggaggaaggacaaaggaaagagcgatgcctacattaaatcaattgattcgtcatggtag 14853  T
101 cgaaggaaaacggcacacagaccgtactcaagcttcagatcaatgttcccataagcaaagagtatgcccgattgtttttaagagaacac 189  Q
     |||| |||||||| ||| |||||||||| |||||| ||||||||| |||| |||||| ||||| |||||  |||||||||||||||||    
14852 agaagaaaaacggcgcacggaccgtactcgagcttcggatcaatgtccccagaagcaaggagtacgcccgcgtgtttttaagagaacac 14764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 92 - 189
Target Start/End: Original strand, 37882354 - 37882451
Alignment:
92 tcatggtagcgaaggaaaacggcacacagaccgtactcaagcttcagatcaatgttcccataagcaaagagtatgcccgattgtttttaagagaacac 189  Q
    ||||||||| |||| |||||||| ||| |||||||||| |||||| ||||||||| |||| |||||| ||||| |||||  |||||||||||||||||    
37882354 tcatggtagagaagaaaaacggcgcacggaccgtactcgagcttcggatcaatgtccccagaagcaaggagtacgcccgcgtgtttttaagagaacac 37882451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University