View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10066_low_12 (Length: 267)
Name: NF10066_low_12
Description: NF10066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10066_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 42479930 - 42479830
Alignment:
| Q |
1 |
gtttggctactgttgctaagtatctggttaagaatgaagatggagtatccatttctgctcttaacctcatgaatcaggataaagttctcatggaaagctg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479930 |
gtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaacctcatgaatcaggataaagttctcatggaaagctg |
42479831 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
42479830 |
g |
42479830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 172 - 251
Target Start/End: Complemental strand, 42479695 - 42479616
Alignment:
| Q |
172 |
attctaggacgaggagtgttaaaatctcactttagatttttgatatggggtaaatataaatgaacaaaatgggtgaatgg |
251 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479695 |
attctaggacgaggagtgttaaaatttacctttagatttttgatatggggtaaatataaatgaacaaaatgggtgaatgg |
42479616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University