View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10066_low_17 (Length: 223)
Name: NF10066_low_17
Description: NF10066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10066_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 72 - 209
Target Start/End: Complemental strand, 38544742 - 38544605
Alignment:
| Q |
72 |
catcctatatggaaatgccaccattcagacctctattctcactctcactaatggtagtttcttctccataggccgtgctttttaccctnnnnnnntacct |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38544742 |
catcctatatggaaatgccaccattcagacctctattctcactctcactaatggtagtttcttctccataggccgtgctttttaccctaaaaaaatacct |
38544643 |
T |
|
| Q |
172 |
atcaaaccgcccaactcttccaccattctcccctttgc |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38544642 |
atcaaaccacccaactcttccaccattctcccctttgc |
38544605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University