View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10066_low_6 (Length: 336)
Name: NF10066_low_6
Description: NF10066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10066_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 51805867 - 51806188
Alignment:
| Q |
1 |
gggaaaatcgccggtgaaggagttgtatgataagtcgaggactctgagatattttaaagacgagaaatcaggaagtgttcctgacaggtgcatcttgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805867 |
gggaaaatcgccggtgaaggagttgtatgataagtcgaggactctgagatattttaaagacgagaaatcaggaagtgttcctgacaggtgcatcttgttc |
51805966 |
T |
|
| Q |
101 |
atgttgagttgttctaagtgagaacagttgattatgctgtttgttgggaacttgaattttgtattaccgaggtttaggacacgtaaatttggaaggtaag |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805967 |
atgttgagtagttctaagtgagaacagttgattatgctgtttgttgggaacttgaattttgtattaccgaggtttaggacacgtaaatttggaaggtaag |
51806066 |
T |
|
| Q |
201 |
agcaaatatttgatgggaagtttccggaaagtgatgaccaacctgaaaaatcaagacttatgatgtctcctttgttgtcacaggtgattccggtgaagtc |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806067 |
agcaaatatttgacgggaagtttccggaaagtgatgaccaacctgaaaaatcaagacttatgatgtctcctttgttgtcacaggtgattccggtgaagtc |
51806166 |
T |
|
| Q |
301 |
gcagattggtttatccactttg |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51806167 |
gcagattggtttatccactttg |
51806188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University